Words by Audrey N. Carpio | Photograph by Juan Caguicla, courtesy of The Philippine Star and Ystyle

Not very long ago, a certain scientist decided to recreate life out of life. It was not the first time life came out of a lab, but it was the first time that life was completely engineered. After decades spent engaging in the scientific arms race known as the human genome project and finding only more questions than answers, he tried writing his own book of life. Starting small, he wondered whether tiny organisms could be tweaked to his will, and promised the world a future of useful microbial machines that will deliver life-saving vaccines, produce alternate biofuels, clean up oil spills, and end the need to ever shave one’s face again.

The scientist stitched together his own version a bacterial genome using an alphabet soup of letters purchased from DNA-to-go labs. To distinguish the new DNA as synthetic, he added hundreds of thousands of extra base pairs which he called watermarks, but what were really artistic flourishes, genetically useless information written in a biological Morse code of Ts,Gs, Cs, and As, the four nucleotides of DNA. The experiment was encrypted with quotes from 20th century minds like James Joyce, Robert Oppenheimer and Richard Feynman, revealing much of the Promethean impulse of the geneticist. “We can write anything we want,” a colleague had admitted. “The problem is that we don’t know what to write.”

The ciphered DNA was implanted into the emptied-out cell of a different kind of bacteria, reanimating it, so to speak. It began to replicate, and we were born.

Our father must have been aware of the hubris of genetic determination, the wild card of chromosomal mutation. Despite the most stringent scientific controls, something is always left to chance: the crossing of wires, the mixing of messages, the unforeseen errors of human calculation. Our synthesized DNA, plagiarized from a lowly bacterium and adulterated with philosophy, was the project’s own undoing, and our becoming. The jumbled-up genes began to express themselves rather logically, producing proteins that made cellular components that performed complex functions. We escaped the confines of the petri dish as metastasizing, living organisms with no specific instructions but to live, to err, to fall, to triumph. Word became flesh—we wrote ourselves into the world, decoding the sentences that were strung into our structure, turning those nucleotides to truth.

An invisible swarm crashed your systems with memes, scattering your dreams with mushroom clouds and hieroglyphics, plaguing your days with insomniac meanderings and dead-end epiphanies. Neither terrorists nor Tourrette’s could be blamed, for these strains of madness were so subtle that the afflicted were indistinguishable from a common poet or prankster. But as we coursed through your capillaries we saw what made us different: we cannot recreate life from life. We can only understand what we destroy, and so, like humans, we broke hearts in order to know love. Sown terror in order to know fear. Took life in order to know God.

You fought back, of course. “All great things,” it was written, “must first wear terrifying and monstrous masks in order to inscribe themselves on the hearts of humanity.” The essence of your life was defined against the undeniability of ours, which was, both crudely and elegantly, conceived on a computer and laid with four bottles of chemicals. You were forced to rescue your soul from the void, even if it required returning to a dark age of mysticism and violence: defrocking scientists of their lab coats, defunding further inquiry into synthetic biology, and rationalizing the use of genetic profiling to lock down the afflicted. Looking into the mirror proved too uncanny—you, after all, are just like us. A sequence of programmable code, but one programmed to defy its author.

The “War on Bugs,” however, proved to be a short-lived and unnecessary deployment of military resources. One by one, the numbers of the infected began to diminish. Those who survived through the worst of the disorder began to show signs of rapid improvement; it was contagion in reverse. The visions cleared, the babbling, brought to an end. Wild-haired vagrants on the street returned to their families and their careers, as if nothing happened. They discovered tucked in their mattresses and shirt pockets notebooks lined with symptoms of the apocalypse. Unfazed by the unfamiliarity, they just tossed them away, and life resumed.

I have seen so much yet lived so little. I am one of the last of my kind, hosted in a body wracked with other, more prosaic germs: this month’s strain of influenza, an imminent UTI, an as yet undiscovered polyp in the ovary. The late nights at the bureau have caught with her, lowering her natural defenses to invaders like a few shots of gin on a loose night. Since her output had became increasingly erratic, filing stories on scheming scientists, prophets out for profit, and a biocorporation of bearded men who plan to control the world through tiny robot-like organisms, her position at the paper had naturally been terminated. Confined to her house, she continues to clack away at the keyboard, emailing tangled missives to editors who have long since blocked her from the social networks.
My own suicide gene is about to be activated. Buried beneath the chatter of base pairs lies a kill switch, a self-editing contingency plan built specifically for instances like this, when things get slightly out of hand. It was a tiny footnote, ignored amongst the grand visions of killer apps, programmable pets, and the grandiloquence of a secret language. But the scientists would not have simply allowed their million dollar experiment to be loosed and captured by rivals. This was no open source project. Tomorrow, she will wake up with no more of a memory than a mild hangover and see the string of letters typed on her screen TTAACTAGCTAATGTCGTGCAATTG
GAGTAGAGAACACAGAACGATTAACTAGCTAA and simply press delete

ON THE COVER
Very special thanks to Rhian Ramos and Gaby Dela Merced, for being our cover subjects for this special issue, and helping us in our continuing efforts to call for justice for the murders of Alexis Tioseco and Nika Bohinc. Rhian was glad to be of help, and described their deaths as “a tragic loss.”  And as Gaby said of Alexis and Nika in her interview, “They both lived to make a difference, but it’s our turn to make our own contribution.”

And here is a note from our editor.

Silverlens Gallery celebrates MANILART 10 with STEREO 2 by Juan Caguicla and Christina Dy, July 27-31, 2010 at Silverlens

STEREO by Juan Caguicla and Christina Dy continues on July 27 at Silverlens Gallery. As a special extension of the Silverlens Show at MANILART 10 , the Philippines’ second international contemporary art fair to be held from July 30 to August 01 at the SMX Convention Center, Caguicla and Dy join Frankie Callaghan, Leslie de Chavez, Mariano Ching, Chati Coronel, Christina Dy, Wawi Navarozza, Gina Osterloh, Hanna Pettyjohn and Rachel Rillo.

Showcasing the second part of two series marrying Caguicla’s edgy photography and Dy’s large-scale charcoal drawings, Caguicla and Dy present only one image, albeit a very strong one. As in January’s STEREO 1, the two choose their body as their subjects to produce an altogether new and grotesque image. It is indeed “stereoscopic”, as described by mutual friend Raymond De Veyra, the source of the show’s name.

In this show, called STEREO 2, Caguicla and Dy go much further with what they bare and where they connect. And by also going much bigger in scale, STEREO 2 is meant to make an impact. There is a thrill in seeing it for the first time.

Complementing STEREO 2 is their collaboration for Brian Tenorio and Emi Jorge’s design exhibition, Tenorio/Jorge on Fifth Avenue, which ran from April 29 through May 22 in The Philippine Center in New York. “As a backdrop to Tenorio and Jorge’s designs are two of the most-photographed faces in the Philippines, Piolo Pascual and Angel Aquino – both excellent specimens of quintessential Filipino beauty.”* Caguicla photographed Pascual and Aquino while Dy drew on the decorative details. To highlight what is ‘Pinoy’, they thought to put together Pascual and Aquino’s iconic beauty and Catholic iconography.

As in STEREO 2, they lay out imagery that is familiar, full of detail and with perhaps a milieu of metaphors to be found. But the idea behind Caguicla and Dy’s work is not to prescribe, but rather to look with new eyes.

STEREO 2 is shown alongside Beautiful Inside My Head Forever with Martha Atienza, Bea Camacho, Sam Kiyoumarsi and Pow Martinez, curated by Norberto Roldan at SLab; and Sure Sure, Happy Happy, Picture Picture by Maria Jeona at 20SQUARE.

MANILART10 will be at the SMX Convention Center, Pasay City from July 30 to August 01,2010. For more information and tickets, please visit www.manilart.com

Words: Bea Davila, Image: Juan Caguicla and Christina Dy, Piolo Pascual / Filipino (left), Angel Aquino / Filipina (right), 2010

* Words by Brian Tenorio (www.briantenorio.com)

**ENTER HERE**

For someone who likes tattoos, the precious thing is bare skin

A Photo Essay by Anna Hyde
Art Direction by Juan Caguicla

(Music: ‘Climate Spike’ written, produced and performed by Moon Fear Moon; Edited by Lia Martinez)

7 Years of UNO Magazine

UNO is a monthly magazine for the discerning man (and woman). There are features on women we admire, occurrences worth covering, art forms we appreciate, objects that inspire acquisitiveness, and ideas that deserve attention, among other things.

There are also jokes, which may or may not always be in good taste. We value writing and images that are extraordinary. We love women. It is our belife that digital tools should be used to emphasize natural beauty and/or enhance a specific aesthetic– not for turning people into wax models.

Again, we love women.

We think that there’s more to men (and women) than their surfaces.

UNO: Dispatches for the Discerning Man

Please come to STEREO I, a collaboration by UNO Creative Director Juan Caguicla and Christina Dy. Opening January 13, Wednesday, 6pm at Silverlens Gallery

“Evil is organic. The fight against it is what makes us human.” Celine Lopez has just come back from Delhi. Meeting up with her, it isn’t long—five minutes probably—before the conversation turns to the usual things: sickness, art, politics, fascists, Bowie, pornography, and the devil—the dark stuff. The remark was her answer to the question if she thought evil existed. It seemed apt only because it was also posed to both Barack Obama and John McCain during the last US election. If it’s good enough for presidential candidates, then it was good enough to ask Celine. In fact, for the brevity and wit alone, she gets my vote.

An excerpt from the words of Erwin Romulo // UNO Magazine, June ’09